human rrm2 reverse (OriGene)
Structured Review

Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/RRM2+Human+qPCR+Primer+Pair/pmc08391410-89-8-14
Average 94 stars, based on 2 article reviews
Images
1) Product Images from "Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment"
Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
Journal: Cancers
doi: 10.3390/cancers13164200
Figure Legend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Techniques Used: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing
Figure Legend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).
Techniques Used: Gene Expression, Expressing
Figure Legend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.
Techniques Used: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot
Related Articles
MTT Viability Assay:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Incubation:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Real-time Polymerase Chain Reaction:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Immunofluorescence:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Western Blot:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Expressing:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Gene Expression:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# Knockdown:Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (# |