Review



human rrm2 reverse  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    OriGene human rrm2 reverse
    MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as <t>RRM2</t> ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
    Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rrm2+reverse/RRM2+Human+qPCR+Primer+Pair/pmc08391410-89-8-14
    Average 94 stars, based on 2 article reviews
    human rrm2 reverse - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment"

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

    Journal: Cancers

    doi: 10.3390/cancers13164200

    MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
    Figure Legend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

    Techniques Used: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

    Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).
    Figure Legend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

    Techniques Used: Gene Expression, Expressing

    Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.
    Figure Legend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

    Techniques Used: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot

    Related Articles

    MTT Viability Assay:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Incubation:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Real-time Polymerase Chain Reaction:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Immunofluorescence:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Western Blot:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Expressing:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Gene Expression:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).

    Knockdown:

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
    Article Snippet: For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).For real-time PCR analysis, we utilized the EvaGreen ® reaction mix (#1725200, Bio-Rad, Hercules, CA, USA) in the 7500 Fast Real-Time PCR Cycler (ThermoScientific TM ).. The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).. Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).Quantification was adjusted using the housekeeping gene GAPDH for human samples forward: 5′-AGC-CTC-CCG-CTT-CGC-TCT-CT-3′ and reverse: 5′-CCA-GGC-GCC-CAA-TAC-GAC-CA-3′ (Microsynth).



    Similar Products

    94
    OriGene human rrm2 reverse
    MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as <t>RRM2</t> ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
    Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rrm2+reverse/RRM2+Human+qPCR+Primer+Pair/pmc08391410-89-8-14
    Average 94 stars, based on 1 article reviews
    human rrm2 reverse - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

    Journal: Cancers

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

    doi: 10.3390/cancers13164200

    Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

    Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

    Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

    Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

    Journal: Cancers

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

    doi: 10.3390/cancers13164200

    Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

    Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

    Techniques: Gene Expression, Expressing

    Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

    Journal: Cancers

    Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

    doi: 10.3390/cancers13164200

    Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

    Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot